STS markers for glutenin coding genes (HMW) in wheat
Name Chromosome 1st primer sequence (5'-3') 2nd primer sequence (5'-3')
D 14 1 BS CGCTTTTACCGAGATTGGTC CCAAAGAGCATCCATGGTGT
E 8 1BL, 1DL TGCTCGGTTCAATTGACTGC TATGGGCCAGTGATTTCCAC
Hor 2 1BS, 1DS. CCACCATGAAGACCTTCCTC ACCTTGCATGGGTTTAGCTG
Pst 340 1BL, 1DL TAGCATCGGTAATCTCTCGC CCCTTTATATACACTGCCGA
D 8 2BS ACTGTCTGTGCCTTGTGATC GGATGTCTCATATGCATGCAC
D 18 2AS CCACTGTTAGGATTAGTGATCC GGACACTAAACTTTAGAGGC
E 16 2AL. CACCATCGTGCAGATGGAGATC CAGACATACATAGATGGAGGC
E2 3BS GTATTTCTACCATGGCTAGC CTGATTTAGTCCTGTGGCAC
G 36 3BL TGTCGCAACACTGTAGCACG GGACATTATCAGTTATCAGC
WG 110 3DL TCTGATACACACCTCCAGCG ACGGCGATCCGTCCACGAGC
His 3 3AS ATGGCCCGCAC(C/G)AAGCAGAC AGCTGGATGTCCTTGGGCAT
B 5 4DL CTCAACTAAGAAGCACCGGC AACCACCTACAACCGGCTTC
D 21 4DL TCTTCCAGTTAGAGATCTCC TCGTTCGTACTAGTAGTACC
G 10 4A, 4BL, 4DL GTGTTGATGTCCTTGAGGCC TGTCCAGCTTCAGCGAGTAC
CMd 4AL., 4BL ATCCACAGCGGCTGTTCCAC TCTGGCCACCGTCATGGTCT
WG 464 4BL, 4DL AGGACTGTGAAGATGCTACT AGTCCAAATGATGTCACAGG
G 44 5BL, 5DL GTACTGATCAAGTTCTGTCATCG CAGCATTATACTGGACGATGC
Pst 319 5BL AGCTGAGCAAGCTTCTTTGG AACATGCTGGGCAACTCCCA
D 1 6DL CGGATCCTATAAAGTAGCGC CTGTCAAAATCTGTTGGGTC
D 17 6DL CAAACAAGCAGCCAGGTAG CTGCTTGGGTCATCATGCAA
G 8 6BS, 6DS CCGTCGATTACTTGAGTAGAC ACCACAGAGTATTGGCTTGC
ABG 458 6BL AGTCTTGCGCATGGTGACAC CACCAATTGCATCAAAGCTC
His 3 7AS ATGGCCCGCAC(C/G)AAGCAGAC GACTTCCT(C/G)GCCGCCTGCAA
WG 686 7AL., 7BL TCGCTTTACCACAATTTCAG GCTGTTCATATAAAAGGAGA